Cookies op Tweakers

Tweakers maakt gebruik van cookies, onder andere om de website te analyseren, het gebruiksgemak te vergroten en advertenties te tonen. Door gebruik te maken van deze website, of door op 'Ga verder' te klikken, geef je toestemming voor het gebruik van cookies. Wil je meer informatie over cookies en hoe ze worden gebruikt, bekijk dan ons cookiebeleid.

Meer informatie

Door , , 116 reacties

Vanaf september biedt de Universiteit Utrecht de universitaire opleiding Gametechnologie aan, de eerste in zijn soort in Nederland. De opleiding leert de studenten nieuwe technologie voor games te onderzoeken en te ontwikkelen.

De Blob - gemaakt door Nederlandse studentenVolgens Mark Overmars, die als hoogleraar Games and Virtual Worlds aan het hoofd staat van de nieuwe studie Gametechnologie van de Universiteit Utrecht, richt de opleiding zich op het ontwerpen en programmeren van games, met nadruk op graphics, animatie, kunstmatige intelligentie en nieuwe vormen van interactie. Volgens Overmars krijgen studenten bovendien een sterke basis in de informatica mee. "De veelzijdigheid van de technologie achter computerspellen komt sterk terug in deze richting. Dit samen met de uitdaging van een universitaire insteek maakt Gametechnologie zo aantrekkelijk", aldus Overmars. De industrie heeft een groot tekort aan hoogopgeleide informatici met kennis van gametechnologie, volgens de hoogleraar. Hij verwacht dan ook dat de studenten na hun opleiding gemakkelijk een baan zullen vinden.

De UU werkt op dit moment al samen met de Hogeschool voor de Kunsten uit Utrecht, die al langer een HBO-opleiding biedt voor het ontwikkelen van games. Ook andere hbo's in Nederland bieden dergelijke opleidingen, maar de UU is de eerste instelling die een opleiding op universitair niveau heeft ontwikkeld. De universiteit biedt een bacheloropleiding en een masterprogramma. De studie begint in september 2010.

Moderatie-faq Wijzig weergave

Reacties (116)

Laat ik even iets rechtzetten.

Gametechnologie is een richting binnen de opleiding Informatica. Je krijgt dus een Informatica diploma (met een speciale aantekening voor gametechnologie) en in principe staan alle Informatica banen dus voor je open. Ongeveer de helft van het programma bestaat uit vakken die speciaal op de gametechnologie gericht zijn, zoals graphics, 3D modelleren, game ontwerp, AI voor games, interactietechnologie en een groot game project. De overige vakken zijn "gewone" Informatica vakken zoals netwerken, databases, data structuren, etc. Je hebt dus uiteindelijk een gedegen Informatica opleiding gevolgd met een groot accent op die aspecten die belangrijk zijn voor het maken van games. Precies datgene wat gamebedrijven graag willen.

We beginnen met C# en XNA omdat dat een uitstekende eerste programmeertaal is om te leren en je er eenvoudig mooi games mee kunt maken. Later in de opleiding leer je ook ander talen zoals Java, Haskell (een functionele taal) en C++. We doen dus echt niet alles in C#.

- Mark
Dank voor de uitleg. Klinkt als een goed idee, deze opleiding! Veel te veel game-studies richten zich op de design kant, met als gevolg een enorm overschot aan afgestudeerde gamedesigners die nergens terecht kunnen en weinig anders kunnen met hun baan. Aan gekwalificeerde programmeurs is echter altijd een tekort, dus dit zou wel eens een prachtige opleiding kunnen zijn!
Ben benieuwd hoeveel arbeidsplaatsen er uiteindelijk voor de toekomstige studenten zijn...

Ik meen mij ooit nog een opendag op de HKU te herinneren waar het hoofdstuk over arbeidskansen begon met het feit dat je recht had op één of andere uitkering als je die opleiding had afgerond

[Reactie gewijzigd door RK88 op 23 februari 2010 15:42]

Ik vraag me af,
persoonlijk hou ik van gamen & wil er wel mijn beroep van maken
maar vraag me af of dit wel de juiste opleiding is?
natuurlijk leer je games maken maar als er veel afstuderen, zal er toch geen plaats zijn op de arbeidsmarkt want zoveel bedrijven zijn er toch ook niet bevestigd in de benelux die echt games maken.
dan zou ik eerder kiezen voor Informatica zelf, het programeren in verschillende talen (java C-sharp .....) dan kan je nogaltijd kiezen wat je doet en heb je meer keus om ergens gaan te werken denk ik
och kom nu mensen!

Even stoppen met posten als je er niets vanaf weet! Nederland heeft redelijk veel gamebedrijfjes. Alleen omdat deze niet massaal spellen maken die op jouw 360, PS3 of andere spelcomputers belanden, betekent niet dat ze er niet zijn. Tuurlijk verdient een advocaat of tandarts meer, maar over salaris praten we hier nu niet.
Qua gamebedrijfjes, indiegames maken een opmars. Games hoeven niet meer top notch übergraphics te zijn. Kleine bedrijfjes spelen daarop in, en spelen leuk mee in de industrie.

Daarbij zijn er niet zo ontzettend veel gameopleidingen in Nederland, en leveren zij dus ook niet duizenden arbeiders per jaar. Dus honderdduizenden gamebedrijven zijn ook echt niet nodig...

En ga eens rondkijken voor je al die onzin blaat man. Één hand te tellen? Dat zal een enorme hand zijn..
Indie developer present ;)
Je leert ook C-sharp, en in de master C++.
Verder staat de studie bol van algemene informatica vakken, want je hebt ook veel algemene kennis nodig om allerlei soorten games te maken.
In Nederland: Bijna 0. Behalve Triumph Studios |(Overlord 1 &2) is er geen fatsoenlijk spel gemaakt in Nederland. Dit komt omdat onze markt nog heel erg in de kinderschoenen staat. Voor spellen moet je in het Oostblok zijn, Amerika of Engeland.
Wat dacht je van Age of Wonders 1&2? Weliswaar ook van Triumph :)
Ik vond RedCat vroeger ook behoorlijk vet.
Haha inderdaad, vroeger best wel veel gespeeld.
Worms kom toch ook uit Nederland? De ontwikkelaar was team 17 als ik mij niet vergis
En killzone dan? Ik ben de naam van die makers kwijt, maar die zitten in Amsterdam.
Zylom games zit trouwens in Eindhoven

[Reactie gewijzigd door Dennis013 op 23 februari 2010 16:41]

die is van GG, en GG krijgt een leuke 'subsidie' van Sony
(soort oneerlijke stimulans?)
GG is een "subsidiary", oftewel dochter van Sony. Dus waar jij de indruk van oneerlijke stimulans nou vandaan hebt? http://en.wikipedia.org/wiki/Guerrilla_Games
en die subsidie wordt omgezet tot een groter game budget >>>> meer programmeurs nodig >>>> groei v.d. industrie
Ik doe niet aan consoles, dus van die titles heb ik geen verstand :)
Laten we Killzone niet vergeten.. :9
Je moet natuurlijk wel in het achterhoofd houden dat de "game-industrie" breder is dan de computerspelletjes die jij, ik en onze buren spelen.

Er bestaan in Nederland een redelijk grote industrie op het gebied van simulatie en virtual reality. Je weet wel: brandweermannen die kunnen oefenen met virtuele rampen in gebouwen, ziekenhuispersoneel met rampen in hun eigen gebouw, dokters die een operatie kunnen oefenen, etc, etc... Allemaal digitaal en wordt ook vaak onder het kopje "game-industry" geschoven. In het beleid van de gemeente Utrecht wel in ieder geval.

Naast elke andere willekeurige programmeerbaan waar ze terecht kunnen na een goede portie programmeerervaring op de opleiding, ligt dus hier ook nog een wereld voor ze open.
Jazz Jackrabbit natuurlijk van Arjan Brussee :)
Wat een onzin. NL is een van de grotere landen in Europa wat de gamesindustrie betreft. Naast een aantal grote studios (ik denk aan Guerilla, Triumph, Karma, W! Games en Engine Software) is de serios games markt heel erg groot, en ook zitten er een aantal belangrijke outsourcees (zoals het Utrechtse Nixxes, dat tal van ports van en technologie voor hele bekende spellen als de Legacy of Kain serie en de Tomb Raider serie heeft ontwikkeld, en momenteel bezig is met de 3D engine en offline tools voor Deus Ex 3 [/shameless plug])

[Reactie gewijzigd door .oisyn op 24 februari 2010 15:59]

Als hier een degelijke wetenschappelijke basis op niveau onder ligt (wat bij de huidige HBO opleidingen helaas vaak ontbreekt) denk ik dat er nog best vraag is naar afgestudeerden van een dergelijke opleiding.

Ik zelf denk dat een dergelijke opleiding vooral goed terug kan komen als een master na een huidige informatica-opleiding. Er zal redelijk wat overlap met informatica zijn, maar doordat het een losse studie is zullen minder relevante delen van de informatica minder tijd in beslag nemen. Of dat goed is of niet weet ik niet, aangezien elk inzicht kan helpen.
Ga er maar niet vanuit.. Het aantal plekken is al extreeeem beperkt, en daar komt dan ook nog bij dat in de gameindustrie het salaris niet hoog is..
Overigens is er vaak meer vraag naar praktijk ervaring (hoe je dingen dus fixed) ipv theoretische ervaring..
Persoonlijk denk ik dus dat dit soort opleidingen verspilling van belastingcenten zijn..
Ga je eens schamen dat je dit durft te zeggen zonder dat je er iets vanaf weet!
Er zijn zeker wel genoeg plekken, en genoeg ruimte voor groei.
Zie ook: http://www.gamesindustrie.nl/
Er zijn idd genoeg plekken ja. Voor talent. Helaas voldoet de gemiddelde afstudeerder van een dergelijke opleiding daar niet echt aan, kan ik uit ervaring melden. Hopelijk brengt deze opleiding daar wat verandering in (en wij zullen er dan ook wel op een of andere manier bij betrokken zijn)
Volgens de Control (het industrieblad van de game industrie) van Januari 2010 groeit het aantal studenten evenredig aan de groei van de industrie: Er is meer dan genoeg werk in de commerciële sector. Aan de andere kant, als je heel graag wilt kun je ook bij de zorg staat aankloppen voor geld. Een medestudent werkte bij de commissie die gaat over de verdeling van het subsidiegeld en kon ons heel precies vertellen hoe je goed geld kon los kloppen en dat het concept heel eenvoudig kan wezen, zelfs incorrect.

Zo vertelde zo ons over een game dat wordt gemaakt om jongeren te wijzen op het gevaar van vet eten. Hiervoor wordt genoeg geld gegeven zodat 5 mensen 2 jaar lang kunnen werken. De clue is echter, het werkt niet! Uit een gesprek met een pedagoog bleek dat de kinderen onbewust getrained worden om vet eten te herkennen. Doordat het spel draait om het wegklikken van vet eten, zullen de spelers beter worden in het herkennen van burgers, patat en chips.

De Nederlandse industrie wordt nu vooral nog gedomineerd door online games en serious games. Ons huidige project gaat zelfs over een game in het ziekenhuis. Het is echter goed mogelijk om hier alsnog een goed draaiende studio te beginnen. De technologie en mensen zijn ter beschikking.
Een HBO is er ook niet voor de wetenschap, daar is juist de universiteit voor.
In principe is de universiteit bedoeld voor het opleiden van onderzoekers en de hbo bedoeld voor het opleiden van probleem-oplossers, ontwikkelaars, bestuurders en decision-makers en zou er geen niveau-verschil moeten zijn. De praktijk is echter anders
(Ik heb zelf de niveauverschillen mogen ervaren.) Overheid en grootbedrijf willen graag universitairen en daar spelen de universiteiten op in, zodat het merendeel van de opleidingen niet meer echt is gericht op het afleveren van onderzoekers.

Afgezien daarvan kijkt men in de universitaire wereld vaak neer op het HBO en wilt ze graag het elitaire aspect behouden, en dat vereist dat het studenten zo moeilijk mogelijk gemaakt wordt zodat zij die het met een degelijk programma nog wel zouden halen nu toch afvallen en alleen de çream-of-the-crop het diploma ook behaald.

Voor de mindere goden blijft dan het HBO over en die moet zich daardoor ook richten op de lagere niveau's.
Afgezien daarvan kijkt men in de universitaire wereld vaak neer op het HBO en wilt ze graag het elitaire aspect behouden, en dat vereist dat het studenten zo moeilijk mogelijk gemaakt wordt zodat zij die het met een degelijk programma nog wel zouden halen nu toch afvallen en alleen de çream-of-the-crop het diploma ook behaald.
Volgens mij is het niveau van de gemiddelde universitaire opleiding al lang niet meer als moeilijk te betitelen, net als op het HBO wordt daar onder druk van het bedrijfsleven het niveau (in negatieve zin) aangepast.
Hoho!

De HKU is een kuntacademie die in de eerste instantie studenten opleidt tot kunstenaar. Er zijn een aantal verschillende gameopleidingen binnen de HKU, waarvan de een wat meer kunstzinnig is dan de ander.
Het gaat erom dat je als kunstenaar een kunstenaarsuitkering kunt ontvangen, als je kunt aantonen afgestudeerd te zijn aan de HKU. Deze wordt met name gebruikt wanneer afgestudeerden lekker aan het kloten willen en hun eigen ding willen maken.

Dat betekent natuurlijk niet dat je niet aan een baan gaat komen! Vrijwel iedereen die afstudeert en als gamedesigner - grafisch, programmeur of anderzijds - aan de slag wil, kan dat prima, bij de grote hoeveelheid Nederlandse bedrijven.

Dit zal bij een universitaire opleiding niet veel anders zijn. Vroeger kwamen alle gamdesigners van zolderkamertjes. Nu van opleidingen waarbij ze gericht te werk gaan en zodoende duidelijk aan kunnen tonen wat hun specialiteit is, en prima aan de bak kunnen.
Ik heb zelf een dergelijke master en ik heb zonder echte problemen een baan gevonden binnen de games industrie. Ik moet daar dan wel bij zeggen dat ik deze niet in NL heb gedaan en daar ook momenteel niet woon of werk.
Laat me raden, de UK of de US.... daar zijn wel genoeg banen te krijgen, maar hier in nederland zijn de gamebedrijven op 1 hand te tellen, waarschijnlijk zelfs op die van tinneke....
Het punt is, als je over genoeg kwaliteiten beschikt om in NL een baan te vinden bij een AAA studio dan heb je die master ook niet nodig gehad. Wellicht wel handig voor je persoonlijke ontwikkeling, maar niet echt als een stok tussen de deur tijdens de sollicitatie. Als je denkt dat je door een dergelijke opleiding meer kansen maakt kom je aan het eind van de rit bedrogen uit.

[Reactie gewijzigd door .oisyn op 24 februari 2010 16:04]

Wat ik me afvraag is bij wat voor werk je in de game-branche een universitaire opleiding nodig hebt in plaats van een HBO-opleiding.
Welke problemen/projecten bij het ontwikkelen van games vragen om een wetenschappelijke benadering?

Of denk ik nu te makkelijk? (geen expert in de game-industrie :+ )

[Reactie gewijzigd door fractus op 23 februari 2010 15:45]

Denk bijvoorbeeld aan botdetectie, of ontwerp waarbij je vooral kijkt naar hoe je het beste interfaces kan maken, hoe je mensen het spel uitlegd. Allemaal kanten waarbij je echt puur wetenschappelijk onderzoek kan doen.
Voor interfaces heb je al studies zoals Interaction Design, en sub-vakken als (tadaa) "Interface Design" waarbij psychologie een erg belangrijke rol speelt.
Kunstmatige intelligentie is al een aparte universitaire opleiding. Ik kan me voorstellen dat als de nadruk (deels) ligt op het verder verdiepen van AI en vormen van interactie tussen software en de gebruiker er wel degelijk een wetenschappelijke basis aan ten grondslag kan liggen.
Game industrie is bijna alleen maar wetenschappelijk,
Informatica als school vak valt bijvoorbeeld ook onder de Bèta vakken.

~Scarabeast~
Op de HBO is eigenlijk de basis om bestaande oplossingen voor problemen toe te passen. Het verschil met WO is dat op het WO er actief gezocht wordt naar nieuwe oplossingen voor bestaande problemen, en dat altijd gekeken wordt of een nieuwe oplossing beter of slechter is dan bestaande oplossingen. Om games van hoog niveau te maken bevindt je je altijd op de rand van de technische mogelijkheden, waar bestaande oplossingen simpelweg niet altijd voor handen zijn. Hier heeft een fatsoenlijk game-bedrijf vaak meer aan iemand die met zijn (of haar) eigen inzicht de juiste oplossing voor een kan verzinnen en beredeneren.
Ik ben nu voor mijn promotie-onderzoek regelmatig in Mathematica aan het programmeren (en nee, de opleiding geneeskunde is daar géén uitmuntende basis voor heb ik gemerkt :)), maar ik merk toch dat er in dat programma veel programma's ontwikkeld worden, op universitair niveau, die "out of the box" bedacht zijn.
Dus waar het beschikbare middel wordt ingepast in de behoefte aan iets wat er niet direct mee samenhangt...

Dit is misschien een stom voorbeeld, maar ik heb het programma ondertussen al voor best veel dingen kunnen gebruiken die niet precies zijn waar het volgens mij voor bedoeld is: zoals het omdraaien van DNA sequenties (ja, TTACGGGGTATCGGGGTAATATATGGC, enz., gedurende enkele duizenden tekens) in een map vol met (een honderdtal) tekstbestanden van die sequenties.
Duurde een half uur tot een uur aan programmeerwerk, en 15 seconden processortijd in plaats van de uren tot dagen die je er anders zoet mee was.

Ik heb geen andere mensen gevonden die dit soort programma's geschreven hebben, terwijl het niet echt moeilijk was, maar het is nu eenmaal niet een "hoofdstukje" uit het Mathematica handboek.

Ik kan me zo voorstellen dat het implementeren van "physics" in games een tijd geleden wel een onderliggende gedachte op WO-niveau kon gebruiken (een natuurkundige kan daarbij geen kwaad als je het goed wil doen namelijk). Als het idee er eenmaal is met een eerste implementatie ervan, kunnen HBO'ers daar uiteraard op voortborduren en het uitbreiden / verbeteren.
Je hebt gelijk dat het een stom voorbeeld is.

Jouw programma kan in 1 regel (4 tokens) worden geschreven in Haskell en in elke andere normale programmeertaal:
main = interact reverse
Een opleiding volgen op een wetenschappelijke instelling (lees: universiteit) betekend niet dat je dat je vervolgens gaan werken aldus een wetenschapelijke benadering. Sterker nog, de meeste mensen die van de universiteit af komen gaan nauwelijks wetenschappenlijk bezig. Een van de reden hiervoor is dat de industrie (elke industrie) gaat om het gewenste resultaat, niet om de manieren waarop tot een resultaat gekomen kan worden.

Persoonlijk zie ik weinig heil in een game specifieke opleiding in de informatica. Ik denk dat het voornamelijk een markting stunt is om meer studenten te trekken.
Ik werk aan middleware in de game-industrie en ik ben binnen dit kleine bedrijf de enige persoon met een achtergrond in computationele geometrie.

Ik zou zeggen dat er heel erg veel aspecten zijn in het ontwikkelen van de technologie (en misschien zelfs een groot deel van de content), waarvoor het handig is als je op een goede universiteit Informatica hebt gestudeerd, of dezelfde kennis op een andere manier hebt opgedaan. Voor mensen met een HBO-opleiding is het gewoon te veel gevraagd om dit soort fundamentele algoritmische ontwikkeling te doen.

En over de term "wetenschap" kan ik alleen maar zeggen dat sommige mensen vinden dat Informatica geen wetenschap is, net zoals wiskunde dit niet is. Het is wel een zeer intellectuele aangelegenheid waar je heel wat bagage voor nodig hebt om daadwerkelijk van nut te kunnen zijn.
Het klink allemaal wel leuk, maar dan gaan ze les geven in C#. Ik denk die dat je bij AAA gamedev bedrijven aan hoeft te komen met alleen C# in je portfolio.
Dat is het eerste jaar.

Ik heb geen verstand van programmeren, maar het is ook niet zo dat je bij natuurkunde meteen de quantum mechanica induikt... Je doet eerst wat basis op
C++ bijvoorbeeld is dan niet het quantum mechanica equivalent.. ook als je nog geen verstand hebt van programmeren, kun je met C++ beginnen. Oke, C++ is ook niet alles, maar toch wel het meest gebruikte als het gaat om het programmeren van games die je in de winkelschappen ziet liggen.
Er is één C++ vak bij de faculteit informatica van de UU. En dat is er pas gekomen na aandringen door studenten die inderdaad iets met games willen gaan doen.
Huh, C#, what are they thinking ze moeten C++ krijgen i.p.v C#(seasharp) of willen ze soms de programmeertaal van de engines veranderen,
Mwah, je moet toch echt ergens beginnen en naar mijn mening is C# is een hele goede stap, zeker zullen ze C++ moeten krijgen anders word het erg lastig voor een programmeur om bij een game studio te werken. Maar C# om het OO principe te leren, ook zullen ze met XNA makkelijk shaders kunnen gebruiken wat weer een soort C is..
Ik programmeer in Haskell (maar ook C, Python, Bash, C++ in zeer uitzonderlijke gevallen) (en dat zijn dan alleen de talen die ik voor mijn werk gebruik). Wat is je punt?
Zijn punt is (naar ik aanneem) dat als je een game-engine gebruikt, dat 'ie dan hoogstwaarschijnlijk niet in C# maar in C++ is geschreven.
Daar 'tegenaan' programmeren is wel mogelijk, maar behalve dat 't traag is, lijkt 't ook een onnodige omweg.

Eerlijk gezegd snapte ik zijn punt beter dan dat van jou?! Het is leuk dat je bekend bent met die talen, maar wat wil je er eigenlijk mee zeggen?
Ik werk ook aan een onderdeel van een game-engine (geschreven in Haskell). Dus, hoewel C++ inderdaad nog een hoop gebruikt wordt, is het niet heilig ofzo. De opleiding waar ze het hier over hebben leert je algoritmische principes die je nodig hebt om game-engines te kunnen bouwen. Als je een goede informatica opleiding volgt, zou de taal waarin je programmeert er totaal niet toe moeten doen.

En natuurlijk begreep ik zijn punt. Het was een rhetorische vraag.
Is haskell (hoewel ik het een leuke taal vind) niet veel te traag voor een game-engine?
Nou ik heb m'n master gehaald bij de HKU en daar hoefde je helemaal niet te kunnen programmeren. Een game designer programmeert in principe ook helemaal niet, daar heb je programmeurs voor, was de gedachte.

Maar om je opmerking te beantwoorden, voor veel engines heb je aan C# meer dan zat. XNA, Unity, noem maar op...
Alle tripple A games worden in C++ geschreven hoor, C# wordt vrijwel enkel gebruikt voor Tools in deze bedrijven. C# geeft een developer nou eenmaal te weinig controlle over de hardware waar het op moet draaien.
En ben jij dan nu game designer? Ik gok van niet.
Je zult toch ergens moeten beginnen. En bovendien zul je als pas afgestudeerde al helemaal niet zomaar bij een triple A gamedev bedrijf binnenkomen. Tenzij je kan aantonen dat je met behulp van school projecten, stages of eigen hobby projecten een bepaalde skill set bezit.
C# zou zo de game design taal van de toekomst kunnen zijn. Naarmate computer kracht toeneemt word de efficiënte van je code ondergeschikt aan de productietijd, gezien het toch goed genoeg presteert op een moderne computer.

Bij de term 'game industrie' hoef je ook niet te denken dat alles niveau Valve / Bethesda / Id Software is. Er zijn een hoop bedrijfjes in NL die zich richten op internet games, Wii ware, etc.
In ieder geval geloof ik dat voor console en PC games(Big Budget games) de hardware nooit snel genoeg wordt om C# te kunnen gebruiken. Het maken van games draait er nu eenmaal om om de hardware tot het maximale te kunnen pushen, en dat kan op het moment gewoon weg nog niet met C# of XNA.
Lekker belangrijk.
driekwart van de tool-chain wordt geschreven in C#,
hlsl-meuk kun je prima doen in C#,
en voor algoritme-onderzoek maakt de taal ook weinig uit.

Mensen die die opleiding doen en er serieus in zijn pakken zelf wel C++ op.
Duidelijk een reactie van iemand die het nog niet echt begrepen heeft. Op een dergelijke opleiding leer je programmeren, geen programmeertaal. De taal waarin je het leert doet er weinig toe, in de kern gaat het om algoritmen en designprincipes. Niet wat de syntax van een programmeertaal is. Iemand die goed kan programmeren, zal een andere taal binnen hetzelfde paradigma zich vrij snel eigen maken.
Zou je niet meer aan ervaring hebben dan aan kennis als het gaat om het ontwikkelen van games?

Ik denk dat alleen een masteropleiding beter zou zijn.
Bij WO is het zoals velen al aangaven de bedoeling om juist tot nieuwe ideeën en technieken te komen. In plaats van reeds bewezen technieken toe te passen. Ervaring is daarbij zeker handig. Maar gezien het feit dat je je voornamelijk op wat onbekender gebied zal bevinden is een WO opleiding erg handig aangezien die je daar beter op kan voorbereiden dan een HBO opleiding. En om toch nog de lat niet te hoog te leggen bieden ze zowel een bachelor als master aan.
Een beste vriend van mij heeft een master multi-media opleiding gevolgd en bij zijn eerste sollicitatie zei men go fuck yourself :). Men had geen interesse in zijn multimediaskills wel zijn programeerkunsten.

M.a.w. better uw programmeringskills gebruiken om SAP applicaties en dergelijke dingen te ontwikkelen.

Hij werkt nu als software architect bij Accenture Consultling: mooie firmawagen en veel poen. ;)

De gamesindustrie is heel interessant maar wil de ecomnomie wil bussines-software en een no-nonsense cultuur.

Waar wel toekomst in zit is in de mini-games zoals de Facebook games naar het schijnt een echte goudmijn :) .
De gamesindustrie is heel interessant maar de economie wil business-software en een no-nonsense cultuur.
(quote even correct gemaakt)

Dit is onzin, zoals je ziet aan de grootte van de game-industrie.
(nog groter dan de film-industrie, dus dan zouden er volgens jou ook geen acteurs M/V meer nodig zijn?)

[Reactie gewijzigd door Ard_ op 23 februari 2010 17:28]

De markt voor business-software is wel vele malen groter.

En als er inderdaad geen acteurs M/V meer nodig zijn omdat alle films makkelijker gerenderd worden op de thuis-pc of i9-handheld dan is dat mischien ook wel interessant.

De bekende acteurs zijn absurd overbetaald en de rest zwaar onderbetaald dus dan is een niet van echt te onderscheiden lekker uitziende animatie interessanter, zeker omdat je deze dan kunt aanpassen aan de voorkeuren van de kijker. Dan wordt echt acteren weer iets voor het theater of voor als liefhebberij.
Als je in de game-industrie wilt werken, raad ik je aan alle vakken te kiezen die de rest te lastig vindt en zoveel mogelijk wiskunde mee te kunnen pakken als mogelijk.

Dit soort opleidingen worden door de game-industrie vaak slecht ontvangen.

[Reactie gewijzigd door gang-ster op 23 februari 2010 17:06]

Hoe kan je nu al zeggen dat dit soort opleidingen vaak slecht ontvangen worden, ze bestaan pas net!
Ik doe zelf HBO Technische informatica bij de Hogeschool Utrecht en daar is ook sinds een paar jaar de mogelijkheid om aftestuderen in Game Technology(ik geloof als minor van Informatica of Technische Informatica).
Aan de hand van de andere reacties kan ik opmaken dat C(++) een belangrijke taal is in de industrie en dat je veel (grafische) wiskunde en algoritmes moet snappen.
Nou dat is precies wat ik nu ook krijg, ik heb zelf al een spel moeten maken voor de Nintendo DS (2D en niet te vergelijke met de spellen op de markt maar wij hadden natuurlijk ook veel minder tijd ervoor). Dus ik zie niet waarom iemand die in de game industrie wil werken niet aan een game opleiding zou beginnen.
Niet dat ik iets met games wil gaan doen overigens, ik ga voor Embedded Systems :) .
Als je in de game-industrie wilt werken raad ik je aan om gewoon je studie te volgen en vakken te kiezen die je interesse trekken. En in je vrije tijd spellen/mods te maken. Men is meer geïnteresseerd in wat je kan dan wat er op je papiertje staat. Eigen initiatief is daarbij een belangrijke factor. En toewijding is ook zeer belangrijk.

[Reactie gewijzigd door elmuerte op 23 februari 2010 23:25]

het is sowieso beetje vaag dat we blijkbaar wel genoeg opleidingen kunnen starten maar zeker niet genoeg bedrijven hebben die al deze mensen kunnen opvangen.

Daar zouden ze eerst is wat meer subsidie/ondersteuning aan moeten geven, voordat er maar weer een opleiding bijkomt.
Ze hadden al een tijdje een opleiding in Utrecht die ongeveer het zelfde voorstelde, maar daar werd eigenlijk niemand van aangenomen in de gamesindustrie omdat ze bijna geen wiskunde deden, want studenten vonden dat niet leuk, maarja de industrie had juist mensen nodig die dat wel konden. Ik hoop dat deze opleiding een wat solidere basis geeft. Maar tbh denk ik nog steeds dat je beter een informatica opleiding kunt doen met dan een minor richting een van de technologieen waar je in verder wilt.

Maarja dat kan deze opleiding zijn natuurlijk :).
Ik studeer Technische Informatica in Delft, met als doel in de game industrie te komen. Misschien dat ik mijn Master dan ook in Utrecht ga volgen als Delft niet binnen 2 jaar met een Game Design master komt :P

Ken Mark Overmars al tijden als de ontwikkelaar van Game Maker. Eerste programma waarmee ik leerde programmeren en spellen ontwerpen :)

[Reactie gewijzigd door Joerdgs op 23 februari 2010 16:43]

Het is geen game design master he :P Het is Game- en Media technology...

De GMT vakken zijn leuk en sluiten goed aan bij MKT... het niveau is de helft van de tijd alleen lager dan van de bachelor in Delft, dat is wel jammer, want met 5 a 10 uur per week studeren haal je je GMT diploma :(

Maar toch een aanrader om GMT master te doen. Uit mijn TU afstudeerjaar zijn er nog 3 anderen naar Utrecht verhuist :P

Op dit item kan niet meer gereageerd worden.



Apple iOS 10 Google Pixel Apple iPhone 7 Sony PlayStation VR AMD Radeon RX 480 4GB Battlefield 1 Google Android Nougat Watch Dogs 2

© 1998 - 2016 de Persgroep Online Services B.V. Tweakers vormt samen met o.a. Autotrack en Carsom.nl de Persgroep Online Services B.V. Hosting door True